Off to Ecuador: Portable DNA Sequencing for Rapid Species Identification in the Field

In the previous post I documented an experiment with the miniPCR amplifying barcodes to ultimately run on a portable gene sequencer (the MinION) developed by Oxford Nanopore Technologies. Here's the protocol on how I prepared the DNA for the MinION in a nutshell and how my colleague, Stefan Prost, and I have analyzed some of the data thus far.

First off, I pooled the 12 barcode PCR products from the miniPCR and began the library preparation using the 1D PCR barcoding amplicons (SQK-LSK108) Protocol. This has three primary steps, mainly End-prep, Adapter ligation, and AMpure XP bead binding. In the End-prep, you mix ~1 µg DNA with Ultra II End-prep reaction buffer & enzyme mix and heat for 5 minutes at 20 °C and 5 minutes at 65 °C, and clean with AMPure beads. Next, you mix the end-prepped DNA with Adapter mix, Blunt/TA Ligation master mix, wash with beads, add Adapter Bead Binding buffer, and elute. This all takes around a couple hours (although taking your time with the bead cleanups seems to help with DNA recovery) and now you’re ready to load the library-prepped DNA into the MinION flow cell!

Loading the sample into the MinION DNA sequencer, which runs off the power of your laptop

I started the sequencing run using the MinKNOW software on 7/3/17. First off, the software determines how many active pores the flow cell contains, which looked pretty good: 497 active pores in group 1, 407 in group 2, 208 group 3, and 39 group 4. Then the run kicked off and the reads started flowing. About one hour in, roughly 15,000 reads had been produced, but it looked like my laptop was getting a bit sluggish (perhaps because I'm using an external SSD drive on my Vaio Sony laptop) and the pore count was dropping off. So I hit the stop acquire button, printed the MinKNOW report and the laptop seemed to catch up on the intensive computing required for the run. I saved the flow cell in the fridge and went on to check out the data from the reads. 

Report given by MinKNOW. No surprise that most of the reads are short length (all the amplicons were ~600 bp to ~1.2 kb. The longer reads are likely the control DNA that ONT provides to run concurrently with your sample.

Stefan Prost working on creating a consensus for the nanopore barcode reads

The barcode reads were basecalled and then demultiplexed with a program called Albacore, which split up barcodes 1 – 12 into different folders. I grabbed a few raw sequences from barcode 1 (the ALS 16S gene), threw it into a BLAST search, and to my pleasant surprise got a snake 16S BLAST hit! Other barcodes appeared to get the correct match as well, which was really encouraging.

Screen shot of some of the raw barcode nanopore data

The next step was to create a consensus for the barcode reads. To do so, we first tested reference based mapping. We used two references, the same PCR amplicon sequenced with Sanger and a reference for a different species from the same genus downloaded from NCBI. We then mapped the reads with BWA mem, an algorithm that can handle divergent reads and sorted and processed the reads using Samtools. We then called the consensus using ANGSD or Geneious, and mapped the reads back to it for post-mapping polishing of the consenus sequence. We performed the polishing using Nanopolish. We then assessed the consensus sequence quality using the Sanger sequence. We see a low error rate for base calls after polishing. The only difference between mapping against the Sanger read and the downloaded reference, was that we missed three few basepair long indels, which weren't present in the downloaded reference (from a different species). We are currently exploring de-novo approaches to create consensus sequences without the use of a reference sequence, such as a program called Canu and the LAST aligment tool.

So overall, after a test trial using the MiniPCR and MinION, we're ready to hit the jungles of Ecuador for real-time portable DNA sequencing! The trial looked promising for basecalling amplicons used for species identification, now to see if we can do it all in the field. Heading to the airport now with Stefan and will post updates soon!

-Aaron Pomerantz & Stefan Prost

Portable PCR! Testing the miniPCR for DNA sequencing in the field

I've recently been testing portable tools for a project to take the "lab into the field". One interesting little piece of equipment I heard about was the miniPCR, a portable thermocycler that has been used for field PCR experiments, for instance "A simple, economical protocol for DNA extraction and amplification where there is no lab".

I got my hands on one of these little gadgets and put it to the test this week to see if I could amplify genes commonly referred to as DNA "barcodes", which are used for species identification and molecular phylogenetic trees, such as: "Molecular phylogeny of Atractus (Serpentes, Dipsadidae), with emphasis on Ecuadorian species and the description of three new taxa ". This snake paper published by my colleagues in Ecuador utilized partial genes sequences of 16S, cytb, and ND4 genes to generate the snake phylogeny below:

Phylogeny depicting relationships within colubrid snakes of the genus Atractus (Arteaga et al. 2017)

My goal was to perform an experiment with the same DNA sequences as the snake paper using the miniPCR to determine if we can perform amplification of these genes outside of a lab setting. The end goal of the PCR amplification is to feed these sequences into the Oxford Nanopore Technologies (ONT) MinION, a portable gene sequencing machine.

The Oxford Nanopore MinION has a barcoding kit, which allows you to pool amplicons. Each primer used for amplification needs a special "universal tail" adapted beforehand, so I ordered primers for 16S, cytb, ND4, as well as COI with the ONT primer tails as follows:

5’ TTTCTGTTGGTGCTGATATTGC-[project-specific forward primer sequence] 3’

5’ ACTTGCCTGTCGCTCTATCTTC-[project-specific reverse primer sequence] 3’

So for example, the 16S primers looks like this:

16S_F_ONT: TTTCTGTTGGTGCTGATATTGCCGCCTGTTTAYCAAAAACAT

16S_R_ONT: ACTTGCCTGTCGCTCTATCTTCCCGGTCTGAACTCAGATCACGT

Now with the primers and miniPCR in hand, I just needed some snake DNA! Lucky for me, a graduate student colleague in another lab at UC Berkeley had plenty of snake samples to work with (below referred to as "ALS" and "BRK"), so we extracted DNA using a standard salt extraction protocol.

I whipped up a standard mix for a PCR reaction [10X PCR buffer (5 ul), MgCl2 (2 ul), dNTP (1 ul), H2O (~41 ul), Taq (platinum Taq) (0.5 ul)] using primers for 16S, cytb, ND4 and COI and ran the miniPCR under following settings:

To test the "portability" aspect of the miniPCR, I ran it at my apartment powered by an external Poweradd battery.

miniPCR + Poweradd battery = portable PCR combo

Here are the result of the first PCR run on a gel after a SPRI bead cleanup:

Left to right: two different ladders (1Kb+), ALS 16S (15.8 ng/ul), ALS ND4 (12.6 ng/ul), BRK 16S (10 ng/ul), BRK Cytb (11 ng/ul). The Drosophila (Dmel) COI samples didn't seem to amplify well.

So not bad with the first round of miniPCR! Overall, the lengths on the gel match the expected amplicon length (16S = 585 bp, ND4 = 901 bp, Cytb = 1209 bp). To play it on the safe side, I also had the amplicons sent off to our DNA sequencing facility on campus and confirmed that they were indeed a match to the expected genes. The exception was the Drosophila sample, which interestingly matched to a Drosophila endosymbiotic bacteria (Wolbachia).

Now for the ONT barcode kit, we need to perform one more round of PCR, this time adding the barcode adapters 1 through 12. I made the scheme below to add barcodes to each individual sample of reptile DNA: ALS and BRK (both reptile species from my colleague at Berkeley) as well as some insect samples Plodia (moth), Junonia (butterfly) from our lab, and a Junonia collected form Peru.

Barcode 1: ALS 16S

Barcode 2: ALS ND4

Barcode 3: BRK 16S

Barcode 4: BRK Cytb

Barcode 5: ALS Cytb

Barcode 6: BRK ND4

Barcode 7: Plodia COI

Barcode 8: Junonia Lab COI

Barcode 9: Junonia Peru COI

Barcode 10: ALS 16S + ALS ND4

Barcode 11: BRK 16S + Junonia Lab COI

Barcode 12: Plodia COI + Junonia Lab COI

The second PCR reaction looked like this: Barcode adapter (2ul), PCR DNA template, H2O (44-47 ul), PCR Master Mix (50 ul) and I let the miniPCR do its thing again:

And some of the gel results:

ALS 16S Barcode 1 (152 ng/ul), ALS ND4 Barcode 2 (156 ng/ul), BRK 16s Barcode 3 (168 ng/ul), BRK Cytb Barcode 4 (157 ng/ul)

So overall, I'm impressed with the miniPCR! It has been consistent and reliable in producing expected amplicons - all within the confines of my apartment kitchen! The Poweradd battery works well to make the miniPCR portable, and each run seems to use ~20-30% of the battery.

The next step involves pooling these barcoded amplicons and sequencing on the MinION, which I have recently done but will dedicate a whole post to the sequencing and analysis next. Stay tuned!

-Aaron

We Found the Rare Pinocchio Lizard in Ecuador!

The city of Quito reminded me in many ways of other major cities in South America: bustling, crowded, lots of taxis, and loud construction. Unlike other cities, however, and much to my surprise, just a short drive from Quito put us in one of the most beautiful environments I'd ever experienced: the cloud forest of Mindo.

Each year, travelers venture to this site for different reasons, including birdwatching, trekking, and river rafting. But we were seeking something in particular and very special: a rare species of anole that few have ever seen in person, known as the Pinocchio lizard.

Watch: The Rare Pinocchio Lizard of Ecuador

The cloud forest of Mindo is situated on the western slopes of the Andes and is home to a diversity of beautiful flora and fauna. During the day, we enjoyed an array of brightly colored hummingbirds and butterflies, but were unsuccessful at spotting the Pinocchio lizard. So we set out on our final night in the hopes of finding our enigmatic anole.

I'm not quite sure how he did it, but master Herpetologist Lucas Bustamante spotted the rare Pinocchio lizard during a night hike through the forest. This was no small feat, as this species of anole likes to hang out high in the canopy and has cryptic camouflage, meaning it blends in very well with the mossy branches and vegetation. Lucas, Jason and I then had to scale up a tree in the middle of the night in order to get close enough to film and photograph this incredible lizard.

The endangered Pinocchio lizard (Anolis proboscis) is found only in this region of cloud forest. The protrusion on the nose is mainly composed of cartilage and is used as a display for attracting females as well as defending territory against rival males

The Pinocchio lizard in his natural environment, blending in amongst the leaves and mossy backdrop.

Face to face with the incredible Pinocchio lizard. Such an amazing opportunity to see this rare animal!

For the past 50 years, the Pinocchio lizard was thought to be extinct, but was recently rediscovered at this location in Mindo. According to herpetologist Lucas Bustamante,

"After the rediscovery in 2005, some studies have been done from national and international universities, trying to understand the Pinocchio lizard's ecology and behavior. Even though, there is still much we need to know about this lizard...it is very important to raise awareness looking forward for his conservation."

We were very fortunate to track down a male during our short visit and report that the population is still present in the region. We hope that by sharing this amazing and endangered creature, we can also help to encourage the protection of the cloud forests of Ecuador so that future generations can experience this habitat along with the incredible endemic species within.

Thanks once more to Lucas Bustamante and the team at Tropical Herping for showing us around the fantastic Mindo Cloud Forest and to Destination Ecuador.

For more jungly updates you can follow along on Twitter & Instagram!